Myocardial injury and cardiovascular dysfunction are the most common complications in patients with sepsis, and effective therapeutic candidate is still lacking. This study aims to investigate the protective effect of oxycodone in the myocardial injury in lipopolysaccharide-induced sepsis and its related signaling pathways. Wildtype and Nrf2-knockout mice, as well as H9c2 cardiomyocytes culture treated with LPS were used as models of septic myocardial injury. In vitro model showed that oxycodone protected the cells from pyroptosis induced by LPS. In vivo model showed oxycodone pretreatment significantly attenuated myocardial pathological damage and improved cardiac function with increased ejection fraction (EF) and fractional shortening (FS) as well as decreased cardiac troponin I (cTnI), creatine kinase isoenzymes MB (CK-MB). Oxycodone also reduced the levels of inflammatory factors and oxidative stress damage induced by LPS, which involves pyroptosis-related proteins including the NLRP3, Caspase-1, ASC, and GSDMD. These changes were mediated by Nrf2 and HO-1 because Nrf2-knockout mice or Nrf2 knockdown in H9c2 cells significantly reversed the beneficial effect of oxycodone on oxidative stress, inflammatory responses and NLRP3-mediated pyroptosis. Our findings proved that oxycodone therapy reduces LPS -induced myocardial injury by suppressing NLRP3-mediated pyroptosis via the Nrf2/HO-1 signaling pathway in vivo and in vitro.

Limb weakness is an uncommon symptom in children, with multiple factors contributing to related diseases, particularly genetic disorders. A nine-year-old boy presented with slowly progressive muscle weakness of the limb-girdle muscles. We evaluated the clinical symptoms, laboratory tests, imaging examinations, and pathological examinations of this proband. We combined whole-exome and Sanger sequencing to identify the novel compound heterozygous pathogenic mutations NM 001849.3: c.1970-10_1978 del CGGCTTGCAGGGACGCGTG and c.2462-3C>A in COL6A2 in this proband inherited from the mother and father, respectively. Mutational confirmation at the mRNA level demonstrated that the proband carried a homozygous abnormal sequence with 23bp deletions (c.2462-2484 del GGACGCGTGTGGGCGTGGTGCAG) at the beginning of exon 26. In contrast, both parents and sibling have normal sequences with no clinical symptoms. The results of this study further expand the mutational spectrum and will be helpful for further molecular diagnosis.