2.1 Transgenic mice
The APPswe/PSEN1dE9 (APP/PS1) transgenic mice co-expressing human APPSwe
and PS1-dE9 mutations with C57BL/6 background, were purchased from the
Jackson Laboratory. The transgenic mice overexpressing human Lf
(GenBank: BC015822.1) in astrocytes (Astro-Lf mice) in a background of
C57BL/6 were generated by Cyagen Biosciences Inc. In brief, the
pRP.ExBi-GFAP-Lf plasmid with GFAP promotor-driven human Lf cDNA
expression was injected into the male pronucleus of fertilized eggs of
C57BL/6 mice, the fertilized eggs were then transferred into the
fallopian tube of pseudopregnant female mice to construct and screen the
Astro-Lf mice. The Astro-Lf mice were crossed with the APP/PS1 mice to
obtain the APP/PS1 mice with astrocytes overexpressing human Lf
(APP/PS1/Lf mice). The DNA from tail biopsies were submitted to the
polymerase chain reaction (PCR) to identify the different genotype mice.
The following primers were used: Lf (human): forward,
ATCGCCAGTCTAGCCCACTC and reverse, TCTCTTTATGCAGCTGACAGGA; Internal
control: forward, ACTCCAAGGCCACTTATCACC and reverse,
ATTGTTACCAACTGGGACGACA. All the mice were housed in cages with free
access to a standard diet and distilled water under standard conditions
(24 ℃, 12 h light-dark cycle). Male mice at the age of 10 months old
were submitted to animal behavioral tests and sacrificed for the
biochemical analyses.