References
Antoniel, M., Traina, F., Merlini, L., Andrenacci, D., Tigani, D., Santi, S., Cenni, V., Sabatelli, P., Faldini, C., & Squarzoni, S. (2020). Tendon Extracellular Matrix Remodeling and Collagen VI Mutations .
Bushby, K. M. D., Collins, J., & Hicks, D. (2014). Collagen type VI myopathies. Advances in Experimental Medicine and Biology ,802 , 185–199. https://doi.org/10.1007/978-94-7-7893-1_12
Carakushansky, G., Ribeiro, M. G., & Kahn, E. (2012). Moderately progressive Ullrich congenital muscular dystrophy. Jornal de Pediatria , 88 (1), 93–96. https://doi.org/10.2223/JPED.2112
Kirschner, J. (2013). Congenital muscular dystrophies. In Handbook of Clinical Neurology (1st ed., Vol. 113). Elsevier B.V. https://doi.org/10.1016/B978-0-444-59565-2.00008-3
Lampe, A. K., & Bushby, K. M. D. (2005). Collagen VI related muscle disorders. Journal of Medical Genetics , 42 (9), 673–685. https://doi.org/10.1136/jmg.2002.002311
Lucarini, L., Giusti, B., Zhang, R. Z., Pan, T. C., Jimenez-Mallebrera, C., Mercuri, E., Muntoni, F., Pepe, G., & Chu, M. L. (2005). A homozygous COL6A2 intron mutation causes in-frame triple-helical deletion and nonsense-mediated mRNA decay in a patient with Ullrich congenital muscular dystrophy. Human Genetics , 117 (5), 460–466. https://doi.org/10.1007/s00439-005-1318-8
Park, Y., Park, M. S., Sung, D. H., Sohn, J. Y., Ki, C. S., & Kim, D. H. (2014). Ullrich congenital muscular dystrophy possibly related with COL6A1 p.Gly302Arg variant. Annals of Rehabilitation Medicine ,38 (2), 292–296. https://doi.org/10.5535/arm.2014.38.2.292
Simsek-Kiper, P. O., Oguz, S., Ergen, F. B., Utine, G. E., Alikasifoglu, M., & Haliloglu, G. (2020). A Revisited Diagnosis of Collagen VI Related Muscular Dystrophy in a Patient with a Novel COL6A2 Variant and 21q223 Deletion. Neuropediatrics , 51 (6), 445–449. https://doi.org/10.1055/s-0040-1714125
Zhang, R. Z., Zou, Y., Pan, T. C., Markova, D., Fertala, A., Hu, Y., Squarzoni, S., Reed, U. C., Marie, S. K. N., Bönnemann, C. G., & Chu, M. L. (2010). Recessive COL6A2 C-globular missense mutations in Ullrich congenital muscular dystrophy: Role of the C2a splice variant.Journal of Biological Chemistry , 285 (13), 10005–10015. https://doi.org/10.1074/jbc.M109.093666
Fig. 1. Genetic and pathological findings of the proband and his parents.
(A) Pedigree of the family with UCMD. The black arrow denotes the proband. B and C indicate the partial DNA sequence chromatograms of splice site mutation in COL6A2. (B) The frameshift mutation (c.1970-10_1978delCGGCTTGCAGGGACGCGTG) in the proband and his mother. (C) The splice site mutation (c.2462-3C>A) in the proband and his father. The black arrows denote the mutation site. (D) Partial RNA sequence chromatograms of the frameshift mutation in COL6A2 show a 23 bp-deletion (GGACGCGTGTGGGCGTGGTGCAG) compared to wild-type. The black arrow indicates the start of the deletion site. (E) Hematoxylin and eosin staining results demonstrate that part of the muscle fiber is replaced with connective and adipose tissues; the sizes are significantly different in the remaining myofibers. Fragmenting and hypercontracted myofibers are visible. The number of fibers with internal nuclei and nuclear bags were evidently increased. (F) The immunohistochemical results indicate that the staining of myofiber membranes is diffusely weakened and even absent (100 μm).