Sandfly amplification
We amplified each sandfly DNA extraction in two separate reactions using the ANML primer pair from Jusino et al. (2019) with the forward primer (GGTCAACAAATCATAAAGATATTGG) and the reverse primer (GGWACTAATCAATTTCCAAATCC). These primers target the COI gene and amplify a broad range of arthropods. Although the primers do not bind without mismatches to all sandflies, after pilot testing we found that this primer pair readily amplified in sandflies and was appropriate for distinguishing sandfly species. Again, we used twin-tags unique to each sample within a library. PCR reactions were carried out in a volume of 15 ul using 3 ul GoTaq Green Master Mix (final concentration of 1x), 0.1 ul of GoTaq DNA Polymerase (final concentration of 0.033 u/ul), 3 ul of forward and reverse primers (final concentration of 0.2 uM), 5.48 ul of water, 0.12 ul of BSA, 0.3 ul of dNTPs, and 3 ul of DNA template. PCR cycling was as follows (Hebert et al., 2003; Jusino et al., 2019): initial denaturing at 94°C for 60 sec; 5 cycles: 94°C for 60 sec, 45°C for 90 sec, 72°C at 90 sec; 35 cycles: 94°C for 60 sec, 50°C for 90 sec, 72°C for 60 sec; and a final extension of 72°C for 7 min.