2.2. RNA Isolation and Quantitative Real Time-PCR
Total RNA was extracted from whole larvae using RNeasy Plus Mini Kit
(Qiagen, Toronto, ON, Canada). One microgram of total RNA input was
reverse transcribed to cDNA using the iScript Reverse Transcription
Supermix (Bio-Rad Laboratories, Mississauga, ON, Canada). The cDNA
equivalent of 15ng total RNA was analyzed in triplicate by RT-qPCR using
the SsoAdvanced SybrGreen PCR mix (Bio-Rad) and the MACHINE Biorad. The
raw data were exported from the CFX Manager™ Software (Bio-Rad, Canada),
and the relative gene expression was calculated using the Relative
Expression Software Tool (REST-2009)[43]. The 18srRNA gene served as
the reference gene to verify changes in the expression of the target
gene tyrosine hydroxylase (TH; which is the marker enzyme for
dopaminergic neurons). The qPCR primers for TH were: forward, 5’-
TTGTGTCCGAGAGCTTTGAG-3‘ and reverse, 5‘- AAGCATTCTGGATCTTGGAGG-3‘; for
18srRNA were: forward, 5’- TCGCTAGTTGGCATCGTTTATG -3‘ and reverse,
5‘-CGGAGGTTCGAAGACGATCA -3‘.