2.4 | Real-time quantitative PCR
Total RNA was isolated from aorta using TRIzol reagent (Invitrogen, Cat# 15596026) and retro-transcribed to cDNA using cDNA PCR kit (Takara Bio Inc., Cat# RR037Q). Real-time quantitative PCR was performed using SYBR-Green-based detection (Takara Bio Inc., Cat# RR420L) with primers commercially synthesized (Sangon Biotech, China). The primer sequences from 5’ to 3’ are: 1) PPARγ2 forward, TCGCTGATGCACTGCCTATG, PPARγ2 reverse, GAGAGGTCCACAGAGCTGATT; 2) internal control β-actin forward, AGAGGGAAATCGTGCGTGAC, β-actin reverse, CAATAGTGATGACCTGGCCGT. Real time quantitative PCR was performed using the following cycling conditions: denaturation, annealing, and extension at 95°C, 57°C and 72°C for 10 s, 30 s, and 10 s, respectively, for 40 cycles. Relative expression of PPARγ2 was analysed using the comparative Ct method (2−ΔΔCt).